Review



negative control sequence  (Gene Tools Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Gene Tools Inc negative control sequence
    Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sequence/product/Gene Tools Inc
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-05
    86/100 stars

    Images



    Similar Products

    sirna sequences  (MedChemExpress)
    95
    MedChemExpress sirna sequences
    Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna sequences/product/MedChemExpress
    Average 95 stars, based on 1 article reviews
    sirna sequences - by Bioz Stars, 2026-05
    95/100 stars
    		  Buy from Supplier
    negative control sequence  (Gene Tools Inc)
    86
    Gene Tools Inc negative control sequence
    Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sequence/product/Gene Tools Inc
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    negative control sirna sequence  (Sangon Biotech)
    86
    Sangon Biotech negative control sirna sequence
    Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna sequence/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    negative control sirna sequence - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    negative control oligonucleotide sequences lv nc  (Genechem)
    86
    Genechem negative control oligonucleotide sequences lv nc
    Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control oligonucleotide sequences lv nc/product/Genechem
    Average 86 stars, based on 1 article reviews
    negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    negative control sequence  (Addgene inc)
    94
    Addgene inc negative control sequence
    Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sequence/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    negative control sequence without 5’ overhangs  (Thermo Fisher)
    90
    Thermo Fisher negative control sequence without 5’ overhangs
    KEY RESOURCES TABLE
    Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sequence without 5’ overhangs/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    negative control sequence without 5’ overhangs - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt  (Shanghai GenePharma)
    90
    Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
    KEY RESOURCES TABLE
    Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna targeting the sequence ttctccgaacgtgtcacgt/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    negative control sirna with scramble sequence  (Sangon Biotech)
    90
    Sangon Biotech negative control sirna with scramble sequence
    KEY RESOURCES TABLE
    Negative Control Sirna With Scramble Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna with scramble sequence/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    negative control sirna with scramble sequence - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: Neuron

    Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

    doi: 10.1016/j.neuron.2025.05.023

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

    Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software